Review





Similar Products

96
TaKaRa random pentamer 5 mer primers
Random Pentamer 5 Mer Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/random pentamer 5 mer primers/product/TaKaRa
Average 96 stars, based on 1 article reviews
random pentamer 5 mer primers - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

99
New England Biolabs neb luna universal qpcr 2 × master mix 5 qpcr primers 4
Neb Luna Universal Qpcr 2 × Master Mix 5 Qpcr Primers 4, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/neb luna universal qpcr 2 × master mix 5 qpcr primers 4/product/New England Biolabs
Average 99 stars, based on 1 article reviews
neb luna universal qpcr 2 × master mix 5 qpcr primers 4 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

99
Illumina Inc primer 5
Primer 5, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5/product/Illumina Inc
Average 99 stars, based on 1 article reviews
primer 5 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

93
Addgene inc primers prsii415 192 5 genome dir
Primers Prsii415 192 5 Genome Dir, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers prsii415 192 5 genome dir/product/Addgene inc
Average 93 stars, based on 1 article reviews
primers prsii415 192 5 genome dir - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc primers 5 tcagatctcgagccaccatggacttcaagaacctgatctggctgaag gag
Primers 5 Tcagatctcgagccaccatggacttcaagaacctgatctggctgaag Gag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers 5 tcagatctcgagccaccatggacttcaagaacctgatctggctgaag gag/product/Addgene inc
Average 93 stars, based on 1 article reviews
primers 5 tcagatctcgagccaccatggacttcaagaacctgatctggctgaag gag - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

99
TaKaRa race reactions
Race Reactions, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/race reactions/product/TaKaRa
Average 99 stars, based on 1 article reviews
race reactions - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

Image Search Results