|
TaKaRa
random pentamer 5 mer primers Random Pentamer 5 Mer Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/random pentamer 5 mer primers/product/TaKaRa Average 96 stars, based on 1 article reviews
random pentamer 5 mer primers - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
neb luna universal qpcr 2 × master mix 5 qpcr primers 4 Neb Luna Universal Qpcr 2 × Master Mix 5 Qpcr Primers 4, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/neb luna universal qpcr 2 × master mix 5 qpcr primers 4/product/New England Biolabs Average 99 stars, based on 1 article reviews
neb luna universal qpcr 2 × master mix 5 qpcr primers 4 - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
Illumina Inc
primer 5 Primer 5, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5/product/Illumina Inc Average 99 stars, based on 1 article reviews
primer 5 - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
Addgene inc
primers prsii415 192 5 genome dir Primers Prsii415 192 5 Genome Dir, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers prsii415 192 5 genome dir/product/Addgene inc Average 93 stars, based on 1 article reviews
primers prsii415 192 5 genome dir - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
primers 5 tcagatctcgagccaccatggacttcaagaacctgatctggctgaag gag Primers 5 Tcagatctcgagccaccatggacttcaagaacctgatctggctgaag Gag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers 5 tcagatctcgagccaccatggacttcaagaacctgatctggctgaag gag/product/Addgene inc Average 93 stars, based on 1 article reviews
primers 5 tcagatctcgagccaccatggacttcaagaacctgatctggctgaag gag - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
TaKaRa
race reactions Race Reactions, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/race reactions/product/TaKaRa Average 99 stars, based on 1 article reviews
race reactions - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |